resource source identifier puc19 linearized vector takara bio 638947 puc19 pssp17 (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
98
Structured Review
TaKaRa
resource source identifier puc19 linearized vector takara bio 638947 puc19 pssp17
Resource Source Identifier Puc19 Linearized Vector Takara Bio 638947 Puc19 Pssp17, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1112 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/source+vector/In-Fusion+Snap+Assembly+Master+Mix/pm41321633-115-2-8
Average 98 stars, based on 1112 article reviews
Resource Source Identifier Puc19 Linearized Vector Takara Bio 638947 Puc19 Pssp17, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 1112 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/source+vector/In-Fusion+Snap+Assembly+Master+Mix/pm41321633-115-2-8
Average 98 stars, based on 1112 article reviews
resource source identifier puc19 linearized vector takara bio 638947 puc19 pssp17 - by Bioz Stars,
2026-11
98/100 stars
Images
Related Articles
other:Article Title: SMARCA4 is a haploinsufficient B cell lymphoma tumor suppressor that fine-tunes centrocyte cell fate decisions. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Raw single ATAC sequencing FASTQ files This paper GSE254908 Raw ATAC-seq FASTQ files This paper GSE254908 Raw RNA-sequencing FASTQ files This paper GSE254908 Gene expression microarray data for primary BL GEO GSE132929 Experimental models: Cell lines Human: Raji cells ATCC CCL-86 Human: HEK293T cells ATCC RRID:CVCL_0063 Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Stock# 000664 Mouse: Cd19cre (B6.129P2(C)- Cd19tm1(cre)Cgn/J) The Jackson Laboratory Stock# 006785 Mouse: AID Cre (B6.129P2-Aicdatm1(cre)Mnz/J) The Jackson Laboratory Stock# 007770 Mouse: CD45.1 (B6.SJL-PtprcaPepcb/Boy) The Jackson Laboratory Stock# 002014 Mouse: Rag1 KO (B6.129S7-Rag1tm1Mom/J) The Jackson Laboratory Stock# 002216 Mouse: R26StopFLMYC (C57BL/6N-Gt (ROSA)26Sortm13(CAG-MYC,-CD2*)Rsky/J) The Jackson Laboratory Stock# 020458 Mouse: GFP-Myc:B6;129-Myctm1Slek/J The Jackson Laboratory Stock#021935 Oligonucleotides gRNA1 for the N-terminal SMARCA4 tagging: TCTGGAGTGGACATCTTCAC This manuscript N/A gRNA2 for the N-terminal SMARCA4 tagging: GTCTGGAGTGGACATCTTCA This manuscript N/A AID-GFP-SMARCA4 N-terminal genotyping Fwd: 5’-CGTCTCCCAAGTTCAAGCGATT-3’ This manuscript N/A AID-GFP-SMARCA4 N-terminal genotyping Rev: 5’-ACATCCAGGGACATGCAAAAGA-3’ This manuscript N/A gRNA1 for knock-in of SMARCA4 point mutation: CAGGACCGAGCCCACCGCAT This manuscript N/A gRNA2 for knock-in of SMARCA4 point mutation: CCGCATCGGGCAGCAGAACG This manuscript N/A Smarca4 mouse genotyping Fwd: 5’—3’ This manuscript N/A Smarca4 mouse genotyping Rev: 5’—3’ This manuscript N/A AID-Cre mouse genotyping common Fwd: 5’- GGACCCAACCCAGGAGGCAGATGT-3’ Robbiani et al.66 N/A AID-Cre mouse genotyping mutant Rev: 5’- CACTCGTTGCATCGACCGGTAATG-3’ Robbiani et al.66 N/A AID-Cre mouse genotyping wildtype Rev: 5’- CCTCTAAGGCTTCGCTGTTATTACCAC-3’ Robbiani et al.66 N/A Myc-KI mouse wildtype Fwd: 5’-CCAAAGTCGCTCTGAGTTGTTATC-3’ Calado et al.25 N/A Myc-KI mouse wildtype Rev: 5’-GAGCGGGAGAAATGGATATG-3’ Calado et al.25 N/A Myc-KI mouse mutant Fwd: 5’-CCAAGAGGGTCAAGTTGGA-3’ Calado et al.25 N/A Myc-KI mouse mutant Rev: 5’-GCAATATGGTGGAAAATAAC-3’ Calado et al.25 N/A GFP-myc mouse common Fwd: 5’- CTGAAAGGGGAGTGGTTCAG-3’ Huang et al.28 N/A GFP-myc mouse wildtype Rev: 5’- ACCGCAACATAGGATGGAGA-3’ Huang et al.28 N/A GFP-myc mouse mutant Rev: 5’- GAACTTCAGGGTCAGCTTGC-3’ Huang et al.28 N/A (Continued on next page) e4 Cancer Cell 42, 605–622.e1–e11, April 8, 2024 Recombinant:Article Title: Nuclear transport surveillance of p53 by nuclear pores in glioblastoma. Article Snippet: Experimental models: Organisms/strains BALB/cSlc-nu/nu mice Charles River Laboratories, Osaka, Japan N/A Oligonucleotides shRNA oligo sequence, see Table S1 This paper N/A Primers for quantitative real-time PCR, see Table S2 This paper N/A (Continued on next page) Cell Reports 42, 112882, August 29, 2023 13 .. REAGENT or Article Title: The Arabidopsis blue-light photoreceptor CRY2 is active in darkness to inhibit root growth. Article Snippet: Article The Arabidopsis blue-light photoreceptor CRY2 is active in darkness to inhibit root growth Software:Article Title: Nuclear transport surveillance of p53 by nuclear pores in glioblastoma. Article Snippet: Experimental models: Organisms/strains BALB/cSlc-nu/nu mice Charles River Laboratories, Osaka, Japan N/A Oligonucleotides shRNA oligo sequence, see Table S1 This paper N/A Primers for quantitative real-time PCR, see Table S2 This paper N/A (Continued on next page) Cell Reports 42, 112882, August 29, 2023 13 .. REAGENT or Article Title: Evaluation of Plasmodium falciparum PSSP17 essentiality in human-to-mosquito transmission and its prospective candidacy as a biomarker. Article Snippet: .. REAGENT or Polymerase Chain Reaction:Article Title: Nuclear transport surveillance of p53 by nuclear pores in glioblastoma. Article Snippet: Experimental models: Organisms/strains BALB/cSlc-nu/nu mice Charles River Laboratories, Osaka, Japan N/A Oligonucleotides shRNA oligo sequence, see Table S1 This paper N/A Primers for quantitative real-time PCR, see Table S2 This paper N/A (Continued on next page) Cell Reports 42, 112882, August 29, 2023 13 .. REAGENT or Plasmid Preparation:Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging Article Snippet: .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and Article Title: A New Strategy for Nucleic Acid Delivery and Protein Expression Using Biocompatible Nanohydrogels of Predefined Sizes Article Snippet: .. The unmodified vector can be used to express mCherry in mammalian Article Title: The Arabidopsis blue-light photoreceptor CRY2 is active in darkness to inhibit root growth. Article Snippet: Article The Arabidopsis blue-light photoreceptor CRY2 is active in darkness to inhibit root growth Article Title: Evaluation of Plasmodium falciparum PSSP17 essentiality in human-to-mosquito transmission and its prospective candidacy as a biomarker. Article Snippet: .. REAGENT or Article Title: A New Strategy for Nucleic Acid Delivery and Protein Expression Using Biocompatible Nanohydrogels of Predefined Sizes. Article Snippet: .. The unmodified vector can be used to express mCherry in mammalian Membrane:Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging Article Snippet: .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and Sequencing:Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging Article Snippet: .. Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and Cloning:Article Title: Evaluation of Plasmodium falciparum PSSP17 essentiality in human-to-mosquito transmission and its prospective candidacy as a biomarker. Article Snippet: .. REAGENT or |